Category:Primers

From PombEvolution
Jump to: navigation, search

Just a list of many of the 'normal' primers. Tm is calculated for 'normal' Taq and only for the homologous region (so not including a possible tail)

No. Primer Name Type Fwd 5` --> 3` Date Tm bp
1 Bart_ssm4_chk_F bahler AACTAAACAATGCAAGCTGGAGTTCATAATAC 23/11/2015 63.7 32
2 Bart_ssm4_chk_R bahler GTCTTTCAGAAGCAAAACAATCATACCAACAC 23/11/2015 64.6 32
3 Bart_ssm4_GFP_R bahler TTGCGAACTCAACCTACATCTCGATACTAGCGGTTTCCCCATCACTGTTGAAGGTGTTAATGGCACTGGCCGATTCAT TCTCTTCAACCTCTCCTCCGTTTTGTATAGTTCATCCATGC 23/11/2015 119
4 Bart_ssm4_int_F bahler AAGAGTCATCAGTGAGAGCCATCATTTCATAAGAGACCGCAGTATAAGAGTCGGGGCATGTAACATTGGTAGCATAATC GCAACCAGAGCTAGAGCAGTTGAATTCGAGCTCGTTTAAAC 23/11/2015 120
5 Bart_ssm4_mCh_tdT_R bahler TTGCGAACTCAACCTACATCTCGATACTAGCGGTTTCCCCATCACTGTTGAAGGTGTTAATGGCACTGGCCGATT CATTCTCTTCAACCTCTCCTCCGTCTTGTACAGCTCGTCCATGCC 23/11/2015 120
6 Fwd_ssm4_amp bahler AAGAGTCATCAGTGAGAGCCATCATTTC 23/11/2015 64.2 28
7 his5_del_chk_Fwd bahler AACGGACGTTACATTCCCATAC 03/08/2017 59.8 22
8 his5_del_chk_Rev bahler GCATTGAACAGCAAAGTGTCTC 03/08/2017 59.8 22
9 his5_disr_com_Fwd bahler ACAATTTGGATGCAAAATTGTCGTTCTTTTCCTGACATAATCCAATTCATCTTTA CAACACTCCCTTCGTGCTTGGGACTGAATTCGAGCTCGTTTAAAC 03/08/2017 100
10 his5_disr_RED_Rev bahler TTTTGTAGAAAGAAATACGAACGAAACGAAAATCAGCGTTGCCATCGCTTTGGA CAAAGCTCCCTTACCTGAAGAGTCGCTTGTACAGCTCGTCCATGCC 03/08/2017 60 100
11 his7_del_chk_Fwd bahler TGTTTCCTAACCAAGCAAGGAT 03/08/2017 59.6 22
12 his7_del_chk_Rev bahler CTCAGGAGATGGAAAAAGCCTA 03/08/2017 59.1 22
13 his7_disr_com_Fwd bahler TAGGAATAAGTCGAGCAACAAATACCAGCCAGTGGCTAATGAAGTCTGAGTTAT TATCTATCCAGCGCTCAAATTAAACAGAATTCGAGCTCGTTTAAAC 03/08/2017 100
14 his7_disr_RED_Rev bahler TGAGAGTGATGCTTCTGAAGAGTTAGGATGGCTTAAGTACGTCGGCAGAGTGCA AACAAGAGTGTTTCCTCAGCATTTCCTTGTACAGCTCGTCCATGCC 03/08/2017 60 100
15 leu1_chk_F bahler AAGCGCTGATAATTGAGGCTAC 60.2 22
16 leu1_chk_R bahler TCGGGTTGTCATCGTTACAATA 58.9 22
17 leu1_comm_disr_Fwd bahler AACCAGGCATTTTTGCGGTAGGGTCTGAAACTTTCACGAAACCATTTCACAACAAAACTTCTTCAACAAC-GAATTCGAGCTCGTTTAAAC 91
18 leu1_GFP_disr_Rev bahler CACAGCGACAACTCGGTCATAAAGTTGAACGGATGTCGTAAATCAATTCCATGCTTTTGCAACTTAATAC-TTTGTATAGTTCATCCATGC 91
19 leu1_RED_disr_Rev bahler CACAGCGACAACTCGGTCATAAAGTTGAACGGATGTCGTAAATCAATTCCATGCTTTTGCAACTTAATAC-CTTGTACAGCTCGTCCATGCC 92
20 mCh_detect_R bahler AATTTTGGGAATAGCGCAAG 14/01/2016 56.4 20
21 mCh_detect_F bahler TGGACTTTGCGTATGAGACG 14/01/2016 59.4 20
22 Rev_ssm4_amp bahler AACTCAACCTACATCTCGATACTAGCG 23/11/2015 63.1 27
23 hph_H1extend_XbaI_Rev cloning ATCGTATCTAGAATATCTCGTTAGAGGGAAGGGGAAGGTAGAAGGGCGCACACAA AAAGGGAAAATTGGAGGGAGAAACTGGATGGCGGCGTTAGTAT 03/08/2017 98
24 hph_NotI_Fwd cloning TGTCAAGCGGCCGCCGCCAGATCTGTTTAGCTTGCC 03/08/2017 78.9 36
25 natMX_F cloning GACATGGAGGCCCAGAATAC 03/08/2017 59.4 20
26 natMX_R cloning CAGTATAGCGACCAGCATTC 03/08/2017 57.4 21
27 Sp_H1_Rev cloning ACGAGAGAAAACAAAGGAGAAAGACT 03/08/2017 61.9 26
28 Sp_mat1M_1_Rev cloning GGCATTACAGTGCTTAGAACTACGT 03/08/2017 62.3 25
29 Sp_mat1M_2_Rev cloning TCGATAGAATCAGGGCAGT 03/08/2017 57.1 19
30 Sp_mat1P_1_Rev cloning TCGTAGAATTGGCCCATTAAAACTGA 03/08/2017 62.3 26
31 Sp_mat1P_2_Rev cloning TCGTAGAATTGGCCCATTAAAACT 03/08/2017 60.2 24
32 cenH-L-F mat AGACACATCGCCCAGTACTTT 24/06/2015 61.1 21
33 cenH-L-R mat TGCAGGACTCTTGATGTTGC 24/06/2015 60 20
34 cenH-R-F mat GACGGGCAAAATCATTATCG 24/06/2015 56.4 20
35 cenH-R-R mat TTTGCCAAATTGCTCCTCAT 24/06/2015 58 20
36 R-kan cloning ACGTGAGTCTTTTCCTTACC 59.3 21
37 IR-L-left-Fwd mat ATCGCTTGTTTCCCATAGCA 23/11/2015 58.6 20
38 IR-R-right-Rev mat CCGTTTCAGGTTCGGAGATA 58.6 20
39 ade6_2_F other AAGGCGCTGGTATATATGGTGT 20/03/2015 61 22
40 K-reg-1-F mat CGTTGGCTTTTGTTGCACTA 24/06/2015 59.8 20
41 K-reg-1-R mat TCGTGGTATTCGGAAATATCG 24/06/2015 56.9 21
42 K-reg-2-F mat CACGAAAGGGAAACGACAAT 24/06/2015 58 20
43 K-reg-2-R mat TGATGATGAGGGTGACGGTA 24/06/2015 59.7 20
44 Mat1_L_F mat GGTGAGTAGGAAGGCGGTAA 29/07/2015 60.6 20
45 matP-start-Rv mat TATCAGGAGATTGGGCAGGTGC 13/11/17 22
46 mat1l-K-1-F mat TGGGATGAGTGCTTGCTTTG 29/07/2015 60.4 20
47 mat1l-K-1-R mat TCGACGGATATGATCTACAATGC 29/07/2015 59.4 23
48 mat1l-K-2-R mat ACGGACTAACAAGGAAGCGT 29/07/2015 61 20
49 mat2:3-1-F mat AACATGTTCCTTCGCCTACG 24/06/2015 59.7 20
50 mat2:3-1-R mat GACAGACTATCGGCCAAACAA 24/06/2015 59.7 21
51 mat2:3-2-R mat ATGTTGGCAAAACGATTGCT 24/06/2015 58.8 20
52 mat-2P-F1 mat tctcttttgcggcgtattct 13/03/2014 59.2 20
53 mat-2P-R1 mat gaccgcgtacggtagtcatc 13/03/2014 61.5 20
54 mat2-rev-M3-F mat TGTGTACCCCATTTGCGTTG 23/11/2015 60.6 20
55 mat2-rev-M3-R mat GGAAGACCGATGACTACCGT 13/03/2014 60.5 20
56 mat3:1-1-F mat TTAACAGGTGCTTGCTTGGC 29/07/2015 60.9 20
57 mat3:1-1-R mat GTAGAAGGGCGCACACAAAA 29/07/2015 60.5 20
58 mat3:1-2-F mat ATCCGTCTCGCCAAACCTAA 29/07/2015 60.8 20
59 mat3:1-2-R mat AATTGGCGGGAGGTAGAGAC 29/07/2015 61 20
60 mat3_very_L_R1 mat GTTCTTCTTACCCGGATAGACA 23/11/2015 58.5 22
61 mat3_very_L_R2 mat GCAGCGTTGAGATAACTTGC 23/11/2015 59 20
62 mat3_very_L_R3 mat TGTCTATCCGGGTAAGAAGAAC 23/11/2015 58.5 22
63 mat-3M-F1 mat cgggttcccctatttcctac 13/03/2014 58.8 20
64 mat-3M-R1 mat ttgaggtcttggcagttgtg 13/03/2014 60 20
65 Mat-minus-F mat ACACCTACCTTGCACTCACA 23/11/2015 60.7 20
66 Mat-minus-R mat CCACATCTCTCCAACCAGCT 20/08/2015 61.2 20
67 Mat-plus-F mat TGTGCGTATTATGGCTTGGTG 23/11/2015 60.4 21
68 Mat-plus-R mat CGGTAGTCATCGGTCTTCCA 20/08/2015 60.5 20
69 rep2_SNP_rev2 snp AACCTGTTGGCGCTCATCTTTG 58.1 23
70 rep2_SNP_Rev snp ATTGCTTCCCTCCTCTCGTGTC 58.2 23
71 matM--start-Rv mat GGGTTCAGTAAATTGGGAAGGCG 13/11/17 23
72 KanChk_Fwd general CGCTATACTGCTGTCGATTCG 28/09/2017 60 22
73 KanChk_Rev general CGGATGTGATGTGAGAACTGTATCCTAGC 28/09/2017 65.7 30
74 rep2_disrupt_Fw bahler CTCTTCTGATGCTCGTGATGCTATTAAATCTGCCCTTCGAAGGAGAATGCGCCGTCGTG AAGGCCGTGTTGAATTCGAGCTCGTTTAAAC 28/09/2017 90
75 rep2_disr_kanMX_Rv bahler ATCTATCACGTCCTCAACAAAAAAGTCCGAAAGCTTAAAGGGAACTTGATTCAAGC AGGTTGCTTCATGCCCCTCACAGACGCGTTGAATTG 28/09/2017 92
76 rep2_SNP_Fw snp AAAGCCAAAATCGCCGGAATGT 28/09/2017 63.5 22
77 rep2_SNP_Rv snp AGGGCTTAATGGCAAGGGTCTT 28/09/2017 64 23
78 byr2_disrupt_Fw bahler CCCCTATCAATCCTAGGAAGTCGGTTAACATCTTCAGCAACAGAAATCCTCAGAGA GGAAAGAGGACAAAGAATTCGAGCTCGTTTAAAC 28/09/2017 90
79 byr2_disr_kanMX_Rv bahler CCGATCATCAACCAAAGCTACTGGAAAAAACAATATCAAACTCTCTTCGTAG AAACCTTAGCATACGTACCCCTCACAGACGCGTTGAATTG 28/09/2017 92
80 byr2_SNP_Fw snp AGTACTTGATGGTTGCCATGCG 28/09/2017 62.9 22
81 byr2_SNP_Rv snp TTGAATCCTACCAGCGACCTCC 28/09/2017 63.4 22
82 silent_mat_del_F bahler TCTTATATTAAATTTTCAAACAAAAAAGACAGACAAACAAGTTTTCGTGAAGAGCTATT GAAAATTCGGGGAATTCGAGCTCGTTTAAAC 28/09/2017 91
83 silent_mat_del_R bahler TTAATATGATACAAGAGCTTTAATAAAAATTAAATTGGAACCGCGACGATCATTTATAATAAGCAAGCAAGCTT GTA CAG CTC GTC CAT GCC 28/09/2017 98
84 byr2_disr_RED_Rv bahler CCGATCATCAACCAAAGCTACTGGAAAAAACAATATCAAACTCTCTTCGTAGAAACCTTAGCATACGTACTT GTA CAG CTC GTC CAT GCC 28/09/2017 96
85 rep2_disr_RED_Rv bahler ATCTATCACGTCCTCAACAAAAAAGTCCGAAAGCTTAAAGGGAACTTGATTCAAGCAGGTTGCTTCATGCTT GTA CAG CTC GTC CAT GCC 28/09/2017 96
86 ade6_1_F other GCGCACTAACTCACTACAATAAAC 59.3 24
87 ade6_2_R other GTTATGTCTATGGTCGCCTATGC 60.2 23
88 pombe-MP-Rev mat TGGAAGACCGATGACTACCGT 29/05/2015 62.3 21
89 ade6_1_R other AGTTGGGCAAGCTTCAATGG 60.8 20
90 GFP_detect_R other GGTTCAGTCACCCAACGATT 14/01/2016 59.7 20
91 GFP_detect_F other ATGCCAGGATTCCTCTTCC 14/01/2016 58.5 19
92 pombe-MT1-Fwd mat agaagagagagtagttgaag 29/05/2015 52.5 20
93 pombe-MM-Rev mat TACGTTCAGTAGACGTAGTG 29/05/2015 55.3 20
94 mat23_del_stitch_fwd mat attgagcagcggttcgatttgcACCTGAATCGCTTCTTGCTTGC 09/10/17 58.2 44
95 mat23_del_stitch_rev mat gcaagcaagaagcgattcaggtGCAAATCGAACCGCTGCTCAAT 09/10/17 58.9 44
96 mat23_del_IR-F_Fwd mat GCGGCATAAACGTGGCATCTAA 09/10/17 58.1 22
97 mat23_del_IR-R_Rev mat TGTGCTGAGGATTAGGACAAACA 09/10/17 55.9 23
98 kanMX_mat23_stitch3_Fwd mat ATATTTCTCTACAGGGGCGCGGACCTGAATCGCTTCTTGCTTGC 09/10/17 58.2 44
99 mat23_kanMX_stitch1_rev mat CAGATGCGAAGTTAAGTGCGCAGCAAATCGAACCGCTGCTCAAT 09/10/17 58.9 44
100 mat23_kanMX_stitch2_Fwd mat ATTGAGCAGCGGTTCGATTTGCTGCGCACTTAACTTCGCATCTG 09/10/17 58.3 44
101 kanMX_mat23_stitch2_Rev mat GCAAGCAAGAAGCGATTCAGGTCCGCGCCCCTGTAGAGAAATAT 09/10/17 58.4 44
102 mat1_fwd GTGGGATGAGTGCTTGCTTTGT 09/10/17 57.8 22
103 mat1M_kanMX_stch1_R CAGATGCGAAGTTAAGTGCGCAAGGAAGCATCACCCTCTAAAACAGT 09/10/17 57.7 47
104 mat1M_kanMX_stch2_F ACTGTTTTAGAGGGTGATGCTTCCTTGCGCACTTAACTTCGCATCTG 09/10/17 58.3 47
105 kMX_mat1_right_stch2_R GGTAGAAGGGCGCACACAAAAACCGCGCCCCTGTAGAGAAATAT 09/10/17 58.4 44
106 kMX_mat1_right_stch3_F ATATTTCTCTACAGGGGCGCGGTTTTTGTGTGCGCCCTTCTACC 09/10/17 58.1 44
107 right_of_mat1_R TAAGGGGAGTACTGTGCAAGGC 09/10/17 58.1 22
108 mat1P_kanMX_stch1_R CAGATGCGAAGTTAAGTGCGCATCGTAGAATTGGCCCATTAAAACTGA 09/10/17 56.7 48
109 mat1P_kanMX_stch2_F TCAGTTTTAATGGGCCAATTCTACGATGCGCACTTAACTTCGCATCTG 09/10/17 56.7 48
110 110_msa1-disr-kanMX6-Rv snp GGAAACTGCATCATCAAGCACCCCTATCCCAAGTTCCTCTTCCAGTGGAGTATTAA ATCCGTCGTCTGTCCGTGGAAAACCAGTTGCCTGTAATACGACTCACTATAGGGAGACC 115
111 111_msa1-disr-kanMX6-Fd snp TGTCACATTTTCCGCCCAAAGTACAGGCCAGGCAGAATGCTTAAGCGCGGTATAGG CTGCGATTGCTTCATCCCTGTAAACAAACCGTACATTTAGGTGACACTATAGAACGC 113
112 112_msa1-SNP-Fwd snp GTGCGTTAGGTGGAGAAAACGG 22/11/17 22
113 113_msa1-SNP-Rev snp cgactgatacgacctccatccc 22/11/17 22
114 116_msa1-stch3-Fwd snp GGTCTCCCTATAGTGAGTCGTATTACAGGCAACTGGTTTTCCACGG 22/11/17 46
115 114_msa1-stch1-Fwd snp ATTTACTGGGTCGAGTTGGCCA 22/11/17 23
116 115_msa1-stch1-Rev snp GCGTTCTATAGTGTCACCTAAATGTACGGTTTGTTTACAGGGATGAAGC 22/11/17 49
117 117_msa1-stch2-Fwd snp GCTTCATCCCTGTAAACAAACCGTACATTTAGGTGACACTATAGAACGC 22/11/17 49
118 118_mfm1-sg-2-Fd mat GTTGCCAGCGTTGACGACAGgttttagagctagaaatagcaagttaaaataa 22/11/17 52
119 119_mfm1-sg-2-Rv mat CTGTCGTCAACGCTGGCAACttcttcggtacaggttatgttttttggcaaca 22/11/17 52
120 120_byr2_stch1_rev snp GTTTAAACGAGCTCGAATTCTTTGTCCTCTTTCCTCTCTGAGG 22/11/17 43
121 121_byr2_stch3_fwd snp GCGTTCTATAGTGTCACCTAAATCTAGGAGGTCGCTGGTAGGATTC 22/11/17 46
122 122_byr2_stch2_Rv snp GAATCCTACCAGCGACCTCCTAGATTTAGGTGACACTATAGAACGC 22/11/17 46
123 123_byr2_stch3_Rv snp ACGAGAGTTTCCACGTCCATGT 22/11/17 22
124 124_rep2_stch1_Rv snp GTTTAAACGAGCTCGAATTCAACACGGCCTTCACGACGG 22/11/17 39
125 125_rep2_stch3_Fd snp GCGTTCTATAGTGTCACCTAAATCGCTCAGTCGTTTTACTCTTGAGAGC 22/11/17 49
126 126_rep2_stch2_Rev snp GCTCTCAAGAGTAAAACGACTGAGCGATTTAGGTGACACTATAGAACGC 22/11/17 49
127 127_kanMX_Clon_Rv cloning AATACGACTCACTATAGGGA 07/02/18 20
128 128_leu1_sg-Rv crispr TGCCAGCGATATCGGGAGCGttcttcggtacaggttatgttttttggcaaca 07/02/18 52
129 129_his5_sg-Fd crispr AAGACTAGTAGCCGCGCGCAgttttagagctagaaatagcaagttaaaataa 07/02/18 52
130 130_his5_sg-Rv crispr TGCGCGCGGCTACTAGTCTTttcttcggtacaggttatgttttttggcaaca 07/02/18 52
131 131_his7_sg-Fd crispr CGAGCAGTATAAGATCCCTCgttttagagctagaaatagcaagttaaaataa 07/02/18 52
132 132_his7_sg-Rv crispr GAGGGATCTTATACTGCTCGttcttcggtacaggttatgttttttggcaaca 07/02/18 52
133 133_leu1_sg-Fd crispr CGCTCCCGATATCGCTGGCAgttttagagctagaaatagcaagttaaaataa 07/02/18 52
134 134_mfm3-prom-Fd cloning ATGCTACTTCGAGCACTGTACC 13/11/17 22
135 135_map2-gene-Fd cloning GGTATTATACCCGGACCTTAATTAGCTCTCAAATTTGGCAGTAATATTG 13/11/17 49
136 136_map2-gene-Rv cloning tttACTTTCTTTACTTAACAATGAAGATCACCGCTGTCAT 13/11/17 40
137 137_mfm3-prom-Rv cloning ATGACAGCGGTGATCTTCATTGTTAAGTAAAGAAAGTaaa 13/11/17 40
138 138_mfm3-term-Fw cloning CAATATTACTGCCAAATTTGAGAGCTAATTAAGGTCCGGGTATAATACC 13/11/17 49
139 139_mfm3_stch2_R crispr/cloning CCTTGGGCATTAAGCTGGGAAT 13/11/17 23
140 140_mfm1-sgFw crispr GCCAGCGTTGACGACAGAGGgttttagagctagaaatagcaagttaaaataa 13/11/17 52
141 141_mfm1-sgRv crispr CCTCTGTCGTCAACGCTGGCttcttcggtacaggttatgttttttggcaaca 13/11/17 52
142 142_mfm1_stch1_R crispr AGCAATTGTACGTCTGCTTGAGAACTTCTTTGTTGGTCGGACCCA 13/11/17 45
143 143_mfm1_stch1_F crispr ATCGCTCTTTCTCCACCCTTCC 13/11/17 23
144 144_mfm1_stch2_R crispr CGTTTCCAAACTCCTGCCGAAG 13/11/17 23
145 145_mfm1_stch2_F crispr TGGGTCCGACCAACAAAGAAGTTCTCAAGCAGACGTACAATTGCT 13/11/17 45
146 146_mfm2_stch1_R crispr TCTGGGGAATTGGCATTTTGCAACCCACGTGCCTTAACTTTCCA 13/11/17 44
147 147_mfm2_stch1_F crispr TCAGCGAACTTCTCTCTTTGGA 13/11/17 23
148 148_mfm2_stch2_R crispr TTGCTTTTTCGTCTCCCGCTTC 13/11/17 23
149 149_mfm2_stch2_F crispr TGGAAAGTTAAGGCACGTGGGTTGCAAAATGCCAATTCCCCAGA 13/11/17 44
150 150_mfm3_stch1_R crispr AAGTTCTATCCGCAAAGCCAGCGACTTCTTTGTTGGTTGGGCCT 13/11/17 44
151 151_mfm3_stch1_F crispr TGTTGAAACCCGGTTTTCGAGT 13/11/17 22
152 152_mfm3_stch2_F crispr AGGCCCAACCAACAAAGAAGTCGCTGGCTTTGCGGATAGAACTT 13/11/17 44
153 153_mfm2-sgFw crispr TGAGTTTTTACAACATCGGTgttttagagctagaaatagcaagttaaaataa 13/11/17 52
154 154_mfm2-sgRv crispr ACCGATGTTGTAAAAACTCAttcttcggtacaggttatgttttttggcaaca 13/11/17 52
155 155_mfm3-sgFw crispr GTTGCCAGTGTTAACGACGGgttttagagctagaaatagcaagttaaaataa 13/11/17 52
156 156_mfm3-sgRv crispr CCGTCGTTAACACTGGCAACttcttcggtacaggttatgttttttggcaaca 13/11/17 52
157 157_inv1_L_F invers CTGCAATACGTGTACGCCACAA 07/02/18 58 22
158 158_inv1_L_R invers AAGTCCAGATCAAGCGACCTCG 07/02/18 58 22
159 159_inv1_R_F invers GTAGCGAGATCAGAGTCCGCTT 07/02/18 58 22
160 160_inv1_R_R invers CCAACCTGCTGTCAAATGCACA 07/02/18 58 22
161 161_inv2_L_F invers GATGCTGTGCCAAGTCTTGCAT 07/02/18 58 22
162 162_inv2_L_R invers ACCACCAAGCTCGAAATGCTTG 07/02/18 58 22
163 163_inv2_R_F invers ACCTGCGTGAATAGCTTCTTGC 07/02/18 58 22
164 164_inv2_R_R invers GCTTGTGGTAGCTTGTTCGCAA 07/02/18 58 22
165 165_inv3_L_F invers GCTTAGGAAACCTCTTGCTCACA 07/02/18 58 23
166 166_inv3_L_R invers GGTGCGTGAACCATTCGATGTT 07/02/18 58 22
167 167_inv3_R_F invers GCTGTAGTGGAAGAGCACCTGA 07/02/18 58 22
168 168_inv3_R_R invers AGGGGAGAAACCACAACCCAAA 07/02/18 58 22
169 169_inv4_L_F invers CGCAACGTTGTATTCCGGTTGA 07/02/18 58 22
170 170_inv4_L_R invers CGTGCAAGGGAATACCACCAAC 07/02/18 58 22
171 171_inv4_R_F invers TGACGATAGAGCGGTAGATGCG 07/02/18 58 22
172 172_inv4_R_R invers GACTTGAGCTCAGTGCCTCAGA 07/02/18 58 22
173 173_inv5_L_F invers TCAACGCCAGTTTTCCGTATGC 07/02/18 58 23
174 174_inv5_L_R invers ACTGGCAAGTATGGTCTCCACC 07/02/18 58 23
175 175_inv5_R_F invers GGGAATTCTGCACAACTGCCAA 07/02/18 58 22
176 176_inv5_R_R invers TGTCATTCGGCGTTAGAAGGGT 07/02/18 58 22
177 177_inv6_L_F invers TGTTCCTCCACTCCAAAGCGAA 07/02/18 58 22
178 178_inv6_L_R invers CGGGTCCTCAATTCGATGTTGC 07/02/18 58 22
179 179_inv6_R_F invers ATTTCGCATCTTCACGTGGCAG 07/02/18 58 23
180 180_inv6_R_R invers TCCTAAAGAGTGGCTGCTTGCT 07/02/18 58 23
181 181_inv7_L_F invers GGGGAAACGAGTGCGCAAATAA 07/02/18 58 22
182 182_inv7_L_R invers ACCACTGGGCCTCATTTCAGTT 07/02/18 58 22
183 183_inv7_R_F invers ACCATCCCTACCAAGAAGTCCG 07/02/18 58 23
184 184_inv7_R_R invers TGGCACTTGAGGTTCTAGGAGG 07/02/18 58 23
185 185_inv8_L_F invers CCGCTAGTTTGGTGAAAGGCTG 07/02/18 58 22
186 186_inv8_L_R invers AAATATGCGACAGTCGGCATGC 07/02/18 58 22
187 187_inv8_R_F invers TTGCCTGTGGATTGCATTGCAT 07/02/18 58 22
188 188_inv8_R_R invers TTGCACATTCCATGACGTCAGC 07/02/18 58 22
189 189_inv9_a_F invers TACAGCCCTGTAGATCCCGAGT 07/02/18 58 22
190 190_inv9_a_R invers CGAAGATACCACCTACGCCCAA 07/02/18 58 22
191 191_inv9_b_F invers TTACTGCTCCCCTGTCCCATTG 07/02/18 58 22
192 192_inv9_b_R invers AGGTAACCCAATGCTGTTTGCG 07/02/18 58 22
193 193_inv9_c_F invers GGTAGCTTGCGCTCTTGTGTTT 07/02/18 58 22
194 194_inv9_c_R invers CCTAAAAGCACGGGGGAACATG 07/02/18 58 22
195 195_mCherry_iPCR_1 cloning GCGCCTACAACGTCAACATCAA 07/02/18 58 22
196 196_mCherry_iPCR_2 cloning CCCACAACGAGGACTACACCAT 07/02/18 58 22
197 197_byr2_sg-Fd crispr GAATTAATAAGCTCGCTAGGgttttagagctagaaatagcaagttaaaataa 07/02/18 52
198 198_byr2_sg-Rv crispr CCTAGCGAGCTTATTAATTCttcttcggtacaggttatgttttttggcaaca 07/02/18 52
199 199_rep2_sg-Fd crispr TGAGCAAATTAAGTTAGGGGgttttagagctagaaatagcaagttaaaataa 07/02/18 52
200 200_rep2_sg-Rv crispr CCCCTAACTTAATTTGCTCAttcttcggtacaggttatgttttttggcaaca 07/02/18 52
201 201_mat1-L_sg-Fd crispr TTAGGGGACCCCACATTAAGgttttagagctagaaatagcaagttaaaataa 07/02/18 52
202 202_mat1-L_sg-Rv crispr CTTAATGTGGGGTCCCCTAAttcttcggtacaggttatgttttttggcaaca 07/02/18 52
203 203_inv5_R_R invers GCAGTCGTTTAGCTATGTTTGCG 07/02/18 59 23
204 204_wtf27_1_sgFw crispr TAAGATTTGTGGTAACGTCGgttttagagctagaaatagcaagttaaaataa 19/02/18 52
205 205_wtf27_1_sgRv crispr CGACGTTACCACAAATCTTAttcttcggtacaggttatgttttttggcaaca 19/02/18 52
206 206_wtf27_2_sgFw crispr AACTTGTAGAAGCAGTGACTgttttagagctagaaatagcaagttaaaataa 19/02/18 52
207 207_wtf27_2_sgRv crispr AGTCACTGCTTCTACAAGTTttcttcggtacaggttatgttttttggcaaca 19/02/18 52
208 208_wtf27_stitch1_fw wtf AAACTTGGGCGAGCTCATTTCG 07/02/18 22
209 209_wtf27_stitch1_rv wtf AGCCTTCAGCACAAGAGAGAGCGGGAAGACATTGCTTCCATCGG 07/02/18 44
210 210_wtf27_stitch2_fd wtf CCGATGGAAGCAATGTCTTCCCGCTCTCTCTTGTGCTGAAGGCT 07/02/18 4
211 211_wtf27_stitch2_rv wtf GCGTCAGTAAACAAGCACCTGT 07/02/18 22
212 212_inv1_L_R invers CGAGGTCGCTTGATCTGGACTT  07/02/18 59 23
213 213_wtf27_stitch1_rv wtf AGCCTTCAGCACAAGAGAGAGCATCACCACATTACTCCCTCTGCT 07/02/18 44
214 214_wtf27_stitch2_fd wtf AGCAGAGGGAGTAATGTGGTGATGCTCTCTCTTGTGCTGAAGGCT 07/02/18 44
215 215_his7_stitch_Rv FlP CATGGAGGCCCAGAATACCCTCTTCGCAGATGATAGCAGTCGGT 16/04/18 44
216 216_his5_stitch_Rv FlP CATGGAGGCCCAGAATACCCTCCAAGCACGAAGGGAGTGTTGTA 16/04/18 44
217 217_mCh_GFP_Fwd FlP GAGGGTATTCTGGGCCTCCATG 16/04/18 59 22
218 218_leu1_stitch_Rv FlP CATGGAGGCCCAGAATACCCTCAACCAGGCATTTTTGCGGTAGG 16/04/18 44
219 219_leu1_stitch_Rv crispr CATGGAGGCCCAGAATACCCTCCCTACCGCAAAAATGCCTGGTT 12/05/18 44
220 220_ECFP_XhoI_Fwd cloning TatAgACTCGAGATGGTGAGCAAGGGCGAGG 12/05/18 31
221 221_ECFP_BamHI_Rev cloning tgcttcGGATCCCTTGTACAGCTCGTCCATGCC 12/05/18 33
222 224_pFA6a_BamHI_Fwd cloning aaggGGATCCatAAGCGAATTTCTTATGATTTATG 12/05/18 35
223 225_pFA6a_XhoI_Rev cloning AAGGCTCGAGtaaCAAAGCGACTATAAGTCAGAAA 12/05/18 35
224 222_YFP_XhoI_Fwd cloning aaattaCTCGAGATGGTGAGCAAGGGCGAGG 12/05/18 31
225 223_YFP_BamHI_Rev cloning ccaataGGATCCGCTTGTACAGCTCGTCCATGC 12/05/18 33
226 226_fluro_General_rv general CGGATCTATATTACCCTGTTAT 12/05/18 22
227 227_leu1_stitch_Rv crispr ATAACAGGGTAATATAGATCCGATGACCGAGTTGTCGCTGTGTA 12/05/18 44
228 228_leu1_stitch3_Rev crispr GTAAGTACACAGCGACAACTCGG 12/05/18 23
229 229_leu1_stitch3_Rev crispr GTTGGGTACATGTGCCAGTTGG 12/05/18 23
230 230_wtf27_Ck_Fw crispr TGAGATTAAGTCATGCACGAGGC 17/05/18 24
231 231_wtf27_Ck_Rv crispr CGAGTAGTTGTTTGCGAACCGG 17/05/18 23
232 232_mfm1_Ck_Fw crispr AGCCACAAGTCATTGTCCGTTT 17/05/18 23
233 233_mfm1_Ck_Rv crispr GACCCTCCGCAAGTCTCTTCTT 17/05/18 23
234 234_mfm2_Ck_Fw crispr CAGCACGAGGAATTCCGTATGC 17/05/18 23
235 235_mfm2_Ck_Rv crispr TGACAGTGGTAAAGAAACGCATGA 17/05/18 25
236 236_mfm3_Ck_Fw crispr GCCTCTTCCGTTGTTAAACCGT 17/05/18 23
237 237_mfm3_Ck_Rv crispr TCCTTGCGCCTTATGATCCAGT 17/05/18 23
238 238_leu1_ck_Fw cloning GACGGCTCTCAACCTCATACCA 12/05/18 22
239 239_leu1_ck_Rv cloning CCTCTGTGGGTTTAAAGACAACTCG 12/05/18 25
240 240_leu1_fluo_insert_Rv cloning TTTGGGAGGTGAGGCTTCTACC 12/05/18 22
241 241_leu1_fluo_insert_Fw cloning AAGTGTACGAGGGCTCTTGACC 12/05/18 22
242 242_his7_insert_Fw cloning ACGAGTTGGCAGACATCTCTCC 22/05/18 23
243 243_his7_insert_Rv cloning ACCGACTGCTATCATCTGCGAA 22/05/18 22
244 244_his5_insert_Fw cloning ACACCACAAGCGAACCGAATTT 17/05/18 23
245 245_his5_fluo-FWD cloning AACAGGGTAATATAGATCCGTTTAACGCCGGCAAAGTTAC 22/05/18 40
246 246_his5_fluo-REV cloning TGGAGGCCCAGAATACCCTCAGTTCTGAAGTCCCAAGCAC 22/05/18 40
247 247_fluo_his5-FWD cloning GTGCTTGGGACTTCAGAACTGAGGGTATTCTGGGCCTCCA 22/05/18 40
248 248_fluo_his5-REV cloning GTAACTTTGCCGGCGTTAAACGGATCTATATTACCCTGTTATCCC 22/05/18 45
249 249_his7_fluo-FWD cloning AACAGGGTAATATAGATCCGAGACCAAGTGCAATACCGAG 22/05/18 40
250 250_his7_fluo-REV cloning TGGAGGCCCAGAATACCCTCCGACCCAAAGTTATTGCGTG 22/05/18 40
251 251_fluo_his7-FWD cloning CACGCAATAACTTTGGGTCGGAGGGTATTCTGGGCCTCCA 22/05/18 40
252 252_fluo_his7-REV cloning CTCGGTATTGCACTTGGTCTCGGATCTATATTACCCTGTTATCCC 22/05/18 45
253 253_leu1_fluo-FWD cloning AACAGGGTAATATAGATCCGAAGTGTACGAGGGCTCTTGA 22/05/18 40
254 254_leu1_fluo-REV cloning TGGAGGCCCAGAATACCCTCTTTGGGAGGTGAGGCTTCTA 22/05/18 40
255 255_fluo_leu1-FWD cloning TAGAAGCCTCACCTCCCAAAGAGGGTATTCTGGGCCTCCA 22/05/18 40
256 256_fluo_leu1-REV cloning TCAAGAGCCCTCGTACACTTCGGATCTATATTACCCTGTTATCCC 22/05/18 45
257 257_his7_strt_Rv cloning CGAGACCAAGTGCAATACCGAG 27/07/18 22
258 258_his7_end_Fw cloning CTCCGACCCAAAGTTATTGCGTG 27/07/18 23
259 259_afterH1_mCh_Fw cloning ACAGGGTAATATAGATCCGTTTTTTGTGTGCGCCCTTCTA 27/07/18 40
260 260_mat1M_mCh_Rv cloning GATGCGAAGTTAAGTGCGCAATGGCATTACAGTGCTTAGA 27/07/18 40
261 261_mCh_mat1M_Fw cloning TCTAAGCACTGTAATGCCATTGCGCACTTAACTTCGCATC 27/07/18 40
262 262_mCh_afterH1_Rv cloning TAGAAGGGCGCACACAAAAAACGGATCTATATTACCCTGTTATC 27/07/18 44
263 263_mCh_mat1P_Fw cloning GATGCGAAGTTAAGTGCGCATCGTAGAATTGGCCCATTAA 27/07/18 40
265 265_Inv10a_Fw invers CACTAGACTGCTACAATTCCCTCTCCTTG 17/07/18 30
266 266_Inv10a_Rv invers AAGGAGATTTATGGGTGCTTTAGGCACG 17/07/18 29
267 267_Inv10b_Fw invers TGACAAATCAAACCAATCCAACATCACTTCTG 17/07/18 33
268 268_Inv10b_Rv invers ACAAACTCAACGAAGATTTGACAAGAGCG 17/07/18 30
269 269_ura4_sg_fw crispr GCTATTCAGCTAGAGCTGAGgttttagagctagaaatagcaagttaaaataa 17/07/18 60 53
270 270_ura4_sg_rv crispr CTCAGCTCTAGCTGAATAGCttcttcggtacaggttatgttttttggcaaca 17/07/18 60 53
271 271_byr2_sgRNA_F crispr ACGTCTCAAGGGCACAATCTgttttagagctagaaatagcaagttaaaataa 17/09/18 60 52
272 272_byr2_sgRNA_R crispr AGATTGTGCCCTTGAGACGTttcttcggtacaggttatgttttttggcaaca 17/09/18 60 52
273 273_rep2_sgRNA_F crispr AGCCGTTGAATGGTTGAACGgttttagagctagaaatagcaagttaaaataa 17/09/18 60 52
274 274_rep2_sgRNA_R crispr CGTTCAACCATTCAACGGCTttcttcggtacaggttatgttttttggcaaca 17/09/18 60 52
275 275_plasmid_eCFP_Fd cloning GCATGGACGAGCTGTACAAGTTTAATTAACAGTTAGGGCGC 03/09/18 60 41
276 276_plasmid_eCFP_Rv cloning TCCTCGCCCTTGCTCACCATGACATGATTTAACAAAGCGAC 03/09/18 60 41
277 277_eCFP_plasmid_Fd cloning TCGCTTTGTTAAATCATGTCATGGTGAGCAAGGGCGAGGA 03/09/18 60 40
278 278_eCFP_plasmid_Rv cloning CGCCCTAACTGTTAATTAAACTTGTACAGCTCGTCCATGC 03/09/18 60 40
279 279_plasmid_YFP_Fd cloning GCATGGACGAGCTGTACAAGTTTAATTAACAGTTAGGGCGC 03/09/18 60 41
280 280_plasmid_YFP_Rv cloning TCCTCGCCCTTGCTCACCATGACATGATTTAACAAAGCGAC 03/09/18 60 41
281 281_YFP_plasmid_Fd cloning TCGCTTTGTTAAATCATGTCATGGTGAGCAAGGGCGAGGA 03/09/18 60 40
282 282_YFP_plasmid_Rv cloning CGCCCTAACTGTTAATTAAACTTGTACAGCTCGTCCATGC 03/09/18 60 40
283 283_map2_HR_Rv CRISPR AAAATTGCTTCACATGGCTTTGTAAAGATGTGTGGGCTAACATACTAGAAAA TAAAAAAAATATGAAGATAAAATGAGTTAATGTATGTGAAAAAAATAA 11/13/2018 64.15°C
284 284_map2_HR_Fw CRISPR CTTTTATTTGCTAGTTCATCGCTTAAACTATCTTTCTTTTTCTAACTTATC AACGAAATTTTATTTTTTTCACATACATTAACTCATTTTATCTTCATAT 11/13/2018 63.33°C
285 285_map2_sgRNA_Fw CRISPR TTGCTAACTGAAACCACACCgttttagagctagaaatagcaagttaaaataa 11/13/2018 64.86°C
286 286_map2_sgRNA_Rv CRISPR GGTGTGGTTTCAGTTAGCAAttcttcggtacaggttatgttttttggcaaca 11/13/2018 68.43°C
287 287_map2_CkFw CRISPR TGCGAATAGGAATACAGATCGT 11/13/2018 53.33°C
288 288_Pmei2_GG_a_Fwd GG TTTGGTCTCTGTGCtgtccatgtttttcgggatgga 10/5/2018 66.89°C
289 289_Pmei2_GG_b_Rev GG tttGGTCTCaCATAcctaaatggcagcagcgaaaca 10/5/2018 65.89°C
290 290_map2_CkRv CRISPR TGTCAACAAACCTGCTCCGT 11/13/2018 56.49°C
291 291_sxa2_sgRNA_Fw CRISPR TTGTATATGCCGCCTGTCCTgttttagagctagaaatagcaagttaaaataa 11/13/2018 65.35°C
292 292_sxa2_sgRNA_Rv CRISPR AGGACAGGCGGCATATACAAttcttcggtacaggttatgttttttggcaaca 11/13/2018 69.53°C
293 293_sxa2_CkFw CRISPR CAAGCCACTGGTTTGGAACG 11/13/2018 56.44°C
294 294_sxa2_CkRv CRISPR TGGGTGTCTTTGTTGCCCAT 11/13/2018 56.42°C
295 295_sxa2_HR_Fw CRISPR CCATATCTTAGTTGTTAATTCAAGCACCATTCtttttttCTTGTAGTCAT GCGGAAATATGATCTAATTATCGTTCCGAGAAAGCGTTAGCGCTAAATTA 11/13/2018 67.84°C
296 296_sxa2_HR_Rv CRISPR TCAAGAATTGTTTCGAAACTGAATACATCAATATATTCCAAATATGATAA ATATTATATTTAATTTAGCGCTAACGCTTTCTCGGAACGATAATTAGATC 11/13/2018 64.97°C
297 297_mfm1_GG_b_Fw GG tttGGTCTCaTATGGACTCAATGGCTAACTC 11/13/2018 59.98°C
298 298_mfm1_GG_d_rev GG tttGGTCTCaAGACTTATGCAATGACACTAAAAT 11/13/2018 59.15°C
299 299_H1_nest_Rv Cloning GTGCAAGGCAATGGTAGCAGTA 11/13/2018 57.35°C
300 300_mat1_nest_Fw Cloning AGTGGGTTAGCCGTGAAAGGAA 11/13/2018 57.95°C
301 301_Prgs1_GG_a_Fwd GG tttGGTCTCaGTGCACAGGAGAGATGCAGTGAACAACT 11/12/2018 67.46°C
302 302_Prgs1_GG_b_Rev GG tttGGTCTCaCATAAAGAAGGGTTATGAAGGGCGGG 11/12/2018 65.46°C
303 303_pBN060_a-to-h-Fw GG CGCGGCCGCcctttGAGACCaaaAAGGGCGAATTCTGCA 11/12/2018 73.75°C
304 304_pBN060_a-to-h-Rv_Nw GG TTTGGTCTCAAAGGGCGGCCGCGTTCTATAGTGAGTCG 11/12/2018 70.22°C
305 305_map3_gg_b_Fw GG tttGGTCTCaTATGTTGCCTATTGGGATTTTC 11/12/2018 59.40°C
306 306_map3_GG_d_Rv GG tttGGTCTCaAGACttaGACATATTTGGCGGCG 11/12/2018 63.68°C
307 307_mam2_GG_d_Rv GG tttGGTCTCaAGACTTACGTCCACTTTTTAGTTT 11/12/2018 60.29°C
308 308_mam2_GG_b_Fw GG tttGGTCTCaTATGAGACAACCATGGTGGaa 11/12/2018 61.25°C
309 309_II2252kb_GG_h_Fw GG tttGGTCTCaAAGGGCGGCCGCTGCAGGGCGAGAAAAACAATCG 11/12/2018 74.28°C
310 310_II2252kb_GG_f_Rv GG tttGGTCTCaGCGGaaGCGGCCGCACTCATTGGGGCGAGATTGTC 11/12/2018 75.39°C
311 311_II2252kb_GG_a_iPCR_Fw GG GTGCtGAGACCttttGGTCTCaATTCGTTCAAGTCCAAGAAGGCTGCC 11/13/2018 70.78°C
312 312_II2252kb_GG_a_iPCR_Rv GG GAATtGAGACCaaaaGGTCTCaGCACTGCTAAGCCAGATCAAAGCTACA 11/13/2018 68.94°C
313 313_M13F cloning TGTAAAACGACGGCCAGT 11/13/2018 53.57°C
314 314_M13R cloning CAGGAAACAGCTATGAC 11/13/2018 46.09°C
315 315_Amp_Rev cloning ATAATACCGCGCCACATAGC 11/13/2018 54.75°C
316 316_II2252kb_Ck_Fw GG TCAGTAGTATGGATCCGACAGT 11/13/2018 53.94°C
317 317_II2252kb_Ck_Rv GG TCGCTTTTGGGAGAATCCTCGT 11/13/2018 58.10°C
318 318_map2_GG_d_Rv GG tttGGTCTCaAGACTTAGCTCTCAAATTTGGCAG 11/13/2018 62.23°C
319 319_map2_GG_b_Fw GG tttGGTCTCaTATGAAGATCACCGCTGTCAT 11/13/2018 61.37°C
320 320_Prgs1_remove_BsaI_Rv GG ATCAGGcCTCCAGCTGTTTTCAATA 11/13/2018 58.32°C
321 321_Prgs1_remove_BsaI_Fw GG AAAACAGCTGGAGgCCTGATTTAGTATCG 11/13/2018 60.61°C
322 322_resist_insert_Ck GG CAGATGCGAAGTTAAGTGCGCA 11/13/2018 58.03°C
323 323_arg1_insert_Ck GG CGGCAAGCAACAGGATTACCTC 12/12/2018 58.02°C 21
324 324_arg1_XbaI_fw GG GCAATATTATCtAGAAGGAAGGGGCGaat 12/12/2018 58.4°C 29
325 325_arg1_XbaI_rv GG CCTTCCTTCTaGATAATATTGCAACTGGttg 12/12/2018 58.02°C 31
330 330_mam2_CkFw CRISPR TCGAACAGCATTCCATTGGT 12/7/2018 54.19°C 20
331 331_mam2_CkRv CRISPR ACGAAGGCAGTTCATTCACT 12/7/2018 53.85°C 20
332 332_map3_CkRv CRISPR TGTTTGCGCATCGTCTTTCG 12/7/2018 56.66°C 20
333 333_map3_CkFw CRISPR ATAGGTGGTTCGCTGCCATC 12/7/2018 56.58°C 20
334 334_map4_CkFw CRISPR TCTCACGTCAATTCGCTGCT 12/7/2018 56.49°C 20
335 335_map4_CkRv CRISPR ATTGAGCACACCATGGGACC 12/7/2018 56.67°C 20
337 337_mam3_CkRv CRISPR TGCCATTCGCTCGTCTACTT 12/7/2018 55.90°C 20
338 338_mam3_CkFw CRISPR TCGAGGGAAGATCTTGCAGC 12/7/2018 56.24°C 20
338 338_mat23_CkFw CRISPR gtgtgcggcataaacgtgg 12/7/2018 56.83°C 19
339 339_mat23_CkRv CRISPR tacaaatgcgtgtgggcttg 12/7/2018 55.86°C 20
351 351_III_780kb_e-a_Fw GG GAATtGAGACCaaaaGGTCTCaGCACAAGGGGCCAAACTAATGCTTCA 1/12/2019 69.61°C
352 352_III_780kb_a-e_Rv GG GTGCtGAGACCttttGGTCTCaATTCCAGAGAAGATGTCTGACGCCCT 1/12/2019 70.66°C
353 353_III_780kb_f_rv GG tttGGTCTCaCCGCATAGGCGTGGTTGCAGACTCAT 1/12/2019 69.46°C
358 358_I_1.25_Ck_Rv GG AGAAGCTGAAGATACCACACCA 1/12/2019 55.18°C
359 359_I_1.25_Ck_Fw GG CGTCTGCATCGTGGAAACTCAC 1/12/2019 58.31°C
360 360_I_1.25_Ck_Rv GG GCGGGGAACAATTGTAAGCCTC 1/12/2019 58.27°C
361 361_I_1.25_Ck_Fw GG TGGTCACAAATCTCCGGTATCGT 1/12/2019 57.69°C
362 362_II_2.03Mb_GG_f_Rv GG tttGGTCTCaCCGCTCCACTCAGAAGAAGACTGTTTCT 1/12/2019 66.97°C
363 363_II_2.03Mb_GG_e-a_Fw GG GAATtGAGACCaaaaGGTCTCaGCACTTGCTGGTCCTGTTATTCGTGT 1/12/2019 69.30°C
364 364_II_2.03Mb_GG_e-a_Rv GG GTGCtGAGACCttttGGTCTCaATTCCTGGTCCCGTAACCCTATTCCG 1/12/2019 70.82°C
367 367_II_2.03Mb_GG_h_Fw GG tttGGTCTCaCCTTGAAACAAGTTGCAGCTTTGGTG 1/12/2019 65.70°C
368 368_mat1GG_e_Rv GG tttGGTCTCaGAATTAAGGGGAGTACTGTGCAAGGC 1/12/2019 65.41°C
369 369_mat1GG_a_Fw GG tttGGTCTCaGTGCGTGGGATGAGTGCTTGCTTTGT 1/12/2019 68.67°C
370 370_GGbb_af_insert_Fw GG GGCCGCGGCCGCTGAGACCAAACCCATTCCCAACCCC 2/1/2019 76.60°C
371 371_GG_bbAmp_Rev GG aAAGGGCGAATTCCAGCACACTGGTCTCaAAGGGCGGCCGCGttCTATAGTGAGTCG 12/3/2019 75.89°C
372 372_bbL0_a_Fw BsaI+BpiI+a fwd GG ttGGTCTCaGCACaaGTCTTCcgaacaaaacaaagaaaaacaagc 1/28/2019 66.99°C
373 373_bbL0_f_Rv BsaI+BpiI+f rev GG aaGGTCTCaCCGCttGTCTTCgcttgtttttctttgttttgttcg 1/28/2019 68.06°C
374 374_bbL0_h_Fw GG ttGGTCTCaCCTTaaGTCTTCcgaacaaaacaaagaaaaacaagc 1/28/2019 65.54°C
375 375_bbL0_e_Rv GG aaGGTCTCaATTCttGTCTTCgcttgtttttctttgttttgttcg 1/28/2019 65.00°C
376 376_map2_GG_g GG tttGGTCTCaTCGTGCGGAACTAGCACTACTATGG 1/28/2019 65.27°C
377 377_Tadh_GG_d_Rv GG tttGGTCTCaAGACTATTACCCTGTTATCCCTAGCG 1/28/2019 63.13°C
378 376_Pmfm3_GG_a GG ttGGTCTCaGTGCAGGTGCTACTTCGAGCACTGTAC 1/28/2019 67.86°C
379 379_Tadh_GG_d_Fw GG tttGGTCTCaGTCTATTACCCTGTTATCCCTAGCG 1/28/2019 63.05°C

This category currently contains no pages or media.